How to order →


  • Purification of unpurified PCR products for Sanger sequencing
  • Sanger sequencing (purified PCR products and plasmid samples)
    Read length
    • Short run: max 700 bp read, on average 550 bp
    • Long run: max 1000 bp read, on average 800 bp
    • recommended length for good quality data is above 120 bp
    Time schedule
    • Normal: 2 to 5 days, orders will be processed upon arrival and data sent when available in our LIMS.
    • Prior: orders will be processed immediately upon arrival and data will be sent when run is finished (orders arrived before 15:00 will be processed the same day)
    Delivered data
    • Raw (ABI files), analyzed (text files), quality scores
    • Data transfer via secured website (https) or attached to email

  • Extra treatment for hairpin structures and high GC content
  • UV/VIS template quantitation
  • Fluorometric template quantitation
  • Plasmid extraction and sequencing
  • Genotyping services (only loading service)
  • Use of primers provided by NSF (free of charge):

    Name Sequence Full Name
    M13FS TGTAAAACGACGGCCAGT M13 Forward
    M13RS CAGGAAACAGCTATGACC M13 Reverse
    SP6 TATTTAGGTGACACTATAG SP6 primer
    T7 TAATACGACTCACTATAGGG T7 primer
    T7term TATGCTAGTTATTGCTCAG T7 terminator
    T3 ATTAACCCTCACTAAAGGGA T3 promotor
  • Free storage of customer primers
  • Up to 3 months template storage
  • Minimum of 6 months sequencing data storage
For prices, please contact us. Special prices possible and reductions awarded depending on the yearly commitment to number of sequencing reactions.


If you require loading service (fragment analysis), please deliver the reactions to the NSF in clearly labeled 96 well plates.
For the reactions, please use primers with fluorescent dyes FAM, VIC, NED, PET and/or LIZ.